Cytosolic PhospholipaseA2-A: A PotentialTherapeuticTarget for Prostate Cancer

Purpose: Cytosolic phospholipase A2-a (cPLA2-a) provides intracellular arachidonic acid to supply both cyclooxygenase and lipoxygenase pathways.We aim to determine the expression and activation of cPLA2-a in prostate cancer cell lines and tissue and the effect of targeting cPLA2-a in vitro and in vivo. Experimental Design:The expression of cPLA2-a was determined in prostate cancer cells by reverse transcription-PCR,Westernblot, and immunocytochemistry. Growth inhibition, apoptosis, and cPLA2-a activity were determined after inhibition with cPLA2-a small interfering RNA or inhibitor (Wyeth-1). Cytosolic PLA2-a inhibitor or vehicle was also administered to prostate cancer xenograft mouse models. Finally, the expression of phosphorylated cPLA2-awas determined by immunohistochemistry in human normal, androgen-sensitive and androgen-insensitive prostate cancer specimens. Results: cPLA2-a is present in all prostate cancer cells lines, but increased in androgen-insensitive cells. Inhibitionwith small interfering RNA orWyeth-1results in significant reductions in prostate cancer cell numbers, as a result of reduced proliferation as well as increased apoptosis, and this was also associated with a reduction in cPLA2-a activity. Expression of cyclin D1and phosphorylation of Akt were also observed to decrease.Wyeth-1inhibited PC3 xenograft growth by f33% and again, also reduced cyclin D1. Immunohistochemistry of human prostate tissue revealed that phosphorylated cPLA2-a is increased when hormone refractory is reached. Conclusions: Expression and activation of cPLA2-a are increased in the androgen-insensitive cancer cell line and tissue. Inhibition of cPLA2-a results in cells and xenograft tumor growth inhibition and serves as a potentially effective therapy for hormone refractory prostate cancer. Previous studies have shown that the eicosanoid pathway is activated in many types of cancers (1) including prostate (2–9). Eicosanoids, which are the products of the cyclooxygenase (COX) and lipoxygenase pathways, contribute to cancer progression by promoting cell proliferation, motility, invasion, and angiogenesis (8–10). Eicosanoids are synthesized from intracellular arachidonic acid, which is released from membrane phospholipids by the action of phospholipase A2 (PLA2; refs. 11, 12). Of the known mammalian PLA2 enzymes, cytosolic PLA2-a (cPLA2-a), an 85-kDa protein, is the predominant source of intracellular arachidonic acid for eicosanoid production. We have previously shown that expression of Annexin II, a calcium-dependent phospholipid-binding protein and inhibitory regulator of cPLA2-a, is lost in human prostate cancer (13). We have also reported that secretory PLA2-IIA (sPLA2-IIA), one of the secretory PLA2s, is overexpressed in prostate cancer cells including those remaining after androgen ablation therapy (14). The growth-promoting effect of sPLA2-IIA seems to be via cPLA2-a (14). These data have prompted us to investigate the role of cPLA2-a in prostate cancer growth, and to determine if it is a feasible target for treatment of the hormone refractory stage of prostate cancer. In this study, we show that cPLA2-a is present in prostate cancer cell lines and increases in androgen-insensitive cells. We also show that small interfering RNA (siRNA) knockdown or specific inhibition of cPLA2-a results in decreased prostate cancer cell growth, through a mechanism of decreased proliferation and, to a lesser extent, increased apoptosis. These effects are at least partially mediated through an inhibition of Human Cancer Biology Authors’Affiliations: Departments of Surgery, Medicine, and Pathology,The University of Sydney; Department of Urology,Westmead Hospital; Department of Endocrinology and Sydney Cancer Centre, Royal Prince Alfred Hospital; and Douglas Hanley Moir Pathology, Sydney, New South Wales, Australia ; Department of Medicine, St.Vincent’s Hospital Clinical School,The University of New SouthWales, Darlinghurst, New SouthWales, Australia; Oncology Research Centre, Prince of Wales Hospital, Randwick, New SouthWales, Australia; and Departments of Chemistry and Biochemistry, University of Washington, Seattle, Washington Received 2/29/08; revised 8/2/08; accepted 8/18/08. Grant support: Australian Urological Foundation grant and University of Sydney R&D grant (M.I. Patel), Cancer Institute NSWFellowship (Q. Dong), Endocrinology and Diabetes Research Foundation (Q. Dong), and NIH grants HL50040 and HL3625 (M.H. Gelb). The costs of publication of this article were defrayed in part by the payment of page charges.This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section1734 solely to indicate this fact. Requests for reprints: Qihan Dong, Division of Medicine, D06, University of Sydney, Sydney, NSW 2006, Australia. Phone: 612-9515-5186; Fax: 612-95161273; E-mail: [email protected]. F2008 American Association for Cancer Research. doi:10.1158/1078-0432.CCR-08-0566 www.aacrjournals.org Clin Cancer Res 2008;14(24) December15, 2008 8070 Akt phosphorylation and a decrease in cyclin D1 expression. We also show that, as seen in vitro, in vivo, inhibition of cPLA2a results in a significant decrease in xenograft tumor growth. Finally, we show that the phosphorylated cPLA2-a (p-cPLA2-a) is present in human prostate tissues and its levels increase in hormone refractory prostate cancer. Materials andMethods Reagents and cell lines. The LNCaP-FGC (LNCaP), DU145, and PC3 human prostate cancer cell lines were purchased from the American Type Culture Collection. Cells were maintained in RPMI 1640 (SigmaAldrich), supplemented with 10% fecal bovine serum (ICN Biomedical) with all cell cultures at 37jC in a humidified environment of 5% CO2. The passage numbers of cells described in this article were between 30 and 45 for LNCaP, 65 and 80 for DU145, and 25 and 40 for PC3. The cPLA2-a inhibitor Wyeth-1 was prepared as previously described (ref. 15; U.S. Patent 6,797,708, Sanmar Chemical Company). Pyrrolidine-2 (also known as pyrrophenone) was prepared as previously described (16). Both inhibitors were reconstituted in DMSO. All antibodies [p (Ser)-cPLA2-a, total cPLA2-a, p (Ser )-Akt, total Akt, GAPDH, and a-tubulin] were obtained from Cell Signaling except cyclin D1 (Sigma). Reverse transcription-PCR. Levels of cPLA2-a mRNA were measured by end-point and real-time reverse transcription-PCR (RT-PCR). After cell treatments, total RNA was isolated using Trizol reagent (Sigma-Aldrich) according to the manufacturer’s instructions. The firststrand complementary DNA was synthesized from 2 Ag of total RNA using a combination of random hexamers and oligo-dT as described previously (13). Endpoint primers were designed based on the human cPLA2-a mRNA (NM_024420), forward 5¶-ACAGTGGGCTCACATTTAACCT, reverse 5¶-CTTCCCGATCAAACACATAAGG. GAPDH was used as the housekeeping gene and its primer sequences are forward 5¶-TGGACCTGACCTGCCGTCTA, reverse 5¶-CCTGTTGCTGTAGCCAAATTC. Conditions for PCR were one cycle of 2 min at 94jC; 40 cycles of 20 s at 94jC, 30 s at 55jC, and 30 s at 72jC; then one cycle of 5 min at 72jC. For real-time PCR, the cPLA2-a primer sequence forward 5¶-ATCCTGATGAATTTGAGCGA, reverse 5¶-CAAGTAGAAGTTCCTTGAACG. TATA box binding protein (TBP) was chosen as the housekeeping gene, forward 5¶-GAACCACGGCACTGATTTTC, reverse 5¶-CCCCACCATGTTCTGAATCT. Quantitative PCR measurements were done with SYBR-Green and ROX as a passive reference using the Rotor-Gene system. Conditions for PCR were one cycle of 2 min at 50jC and 2 min at 95jC; 50 cycles of 30 s at 95jC, 30 s at 65jC, and 30 s at 55jC, followed by one cycle for 10 s at 25jC. The D-D method was used to calculate relative changes in cPLA2-a compared with the housekeeping gene (TBP). Western blotting. Cell lysates were prepared using lysis buffer (20 mmol/L Tris, 150 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L EGTA, 1% Triton X-100, 2.5 mmol/L sodium PPi, 1 mmol/L h-glycerolphosphate), supplemented with 1:50 dilution of protease inhibitor cocktail (Sigma-Aldrich). Protein concentration was quantified using Bio-Rad Protein Assay (Bio-Rad). Cell lysates (60 Ag) were separated on 8% SDSPAGE and then transferred onto a nitrocellulose membrane. The membranes were blocked with 5% nonfat milk containing 0.1% Tween for 1 h. Primary antibodies were incubated overnight at 4jC, washed, and probed with secondary antibodies coupled with peroxide and detected by enhanced chemiluminesence (Amersham Biosciences). Blocking peptide (total and p-cPLA2-a; Cell Signaling) was added at a concentration of 2 Ag/mL to the primary antibody, before being added to the blot. NIH-3T3 and HeLa cells were used as positive controls for detection. Densitometric scanningwas done to quantify band intensities. Immunohistochemistry. Prostate cancer cells were scraped with a rubber policeman and fixed in 10% formalin and embedded in paraffin wax. Human prostate tissue was collected from consenting patients, under Central Sydney Area Health Service (X04-0138) and Western Area Health Service Ethics Committee [HREC 2000/9/4.18(1089)] approval. Localized prostate cancer specimens from the peripheral zone of the prostate were obtained from men who had radical prostatectomy as treatment for their prostate cancer (n = 12). Paired prostate cancer specimens before and after reaching hormone refractory stage were also obtained (n = 7 pairs). These men initially presented with prostate cancer, and tissue was obtained when they underwent transurethral resection of prostate. After the cancers progressed and androgen ablation therapy failed, these men required repeat transurethral resection of prostate. Normal prostate tissue from the peripheral zone was also obtained from organ donors as the control. Cut sections were subject to dewaxing, antigen retrieval, and incubation with primary antibody. Blocking peptide for p-cPLA2-a was added at a concentration of 2 Ag/mL to the primary antibody, before addition to the slide. This was followed by the application of biotinylated secondary antibody and Vectastain ABC kit (Vector) and staining revealed using 3,3¶-diaminobenzidine (DakoCytomation). The staining intensity was graded as low or high, and the percentage of cells stained at each intensity was recorded. cPLA2-a gene silencing with siRNAs. The cPLA2-a–specific sequence TTGAATTTAGTCCATACGAAA (Qiagen) and negative control against the nonmammalian gene, fluorescein AATTCTCCGAACGTGTCACGT were used. Prostate cancer cells were transfected with 5 or 10 nmol/L of siRNA duplexes using HiPerfect Transfection Reagent (Qiagen). Transfection efficiency was confirmed by fluorescence microscopy and